Abstract [Objectives] This study was conducted to provide a basis for the rapid identification of the drug spraying effect in early stage and the molecular mechanism of chemical hybridizing in Brassica napus L.
　　[Methods] Quantitative RT PCR analysis showed that ALS was constitutively expressed in various tissues of 096030， including flower buds， four floral organs （calyxes， petals， stamens and pistils）， roots， stems and leaves. ALS was prominently expressed in leaves and was expressed weakly in the petals and stamens. The male sterility inducing effects of tribenuron methyl on such two Brassica napus L. varieties as Ningyou18 and 096030 were investigated.
　　[Results] Plants were twice sprayed with 0.2 μg/ml tribenuron methyl on leaves. The results showed that 8-10 ml of tribenuron  methyl  was applied per plant for the first time at bolting stage with 1-2 mm flower buds on 15-20 cm inflorescence， and the second spray was performed with 8-10 ml of tribenuron methyl per plant 10 d later. The results showed that the percentage of the full sterile plants reached 100%， which lasted for the whole flowering period， and the relative seed setting rate was only about 4%. Thus， this method could fullfill the requirement of hybrid seed production in field. The in vivo enzyme activity of acetolactate synthase （ALS） was assayed using 2 mm buds collected 3 d after spray. The results showed that 0.2 μg/ml tribenuron methyl inhibited ALS activity. The ALS activity of Ningyou 18 （CK） and Ningyou 18 （0.2 μg/ml） was 3.20 and 1.30 μmol/（mg·h）， respectively， and the ALS activity of 096030 （CK） and 096030 （0.2 μg/ml） was 3.37 and 1.25 μmol/（mg·h） ， respectively. The relative enzyme activity of ALS in Ningyou18 and 096030 was 40.63% and 37.23%， respectively， both of which decreased significantly.
　　[Conclusions] These results showed that the change of ALS activity may be used as an index for quickly identifying and predicting the chemical hybridizing effect of tribenuron methyl.
　　Key words Brassica napus L.; Tribenuron methyl; Male sterility; Expression analysis; Acetolactate synthase
　　At present， the main target of rapeseed breeding in China is the utilization of heterosis in rape， and combining breeding for high quality and breeding for heterosis， namely "heterosis + high quality"， is aimed at breeding high quality hybrids. Practice has shown that rape has obvious heterosis. At present， the main pathways for utilizing the heterosis of rape are cytoplasmic male sterility （CMS）， nuclear male sterility （NMS）， self incompatibility （SI） and chemical hybridizing agent （CHA）[1]. The use of chemical hybridizing agents to produce hybrids has many advantages. Firstly， the CHA method has a wide selection range of parents. The CHA hybrid rape varieties are physiological male sterile materials induced by CHA， and there is no restorer maintainer relationship required in the cytoplasmic nuclear interaction male sterile system. Therefore， the parents are free to choose and can be randomly combined， which is conducive to the selection of excellent ones in superior materials and thus helps to select a combination with strong heterosis. Secondly， the method has short period： The use of CHA allows the direct use of bred varieties that have improved yield and disease resistance as hybrid parents. It does not take a long time to develop， transform， test and cultivate the three lines， and can produce sufficient F 1 seeds in a short time. Thirdly， The CHA method can avoid the problem of little pollen on sterile lines. Fourthly， the heterosis in the F 2 generation can be utilized. The CHA hybrids do not have the problem of fertility restoration， the hybrid progenies are free of fertility segregation， and there is the possibility of achieving multi generation utilization of heterosis. Fifthly， the method can effectively replace artificial emasculation， greatly reducing the workload of breeding[2]. Therefore， the CHA breeding will become an important way to utilize the heterosis of rape. 　　Research and practice have shown that tribenuron methly is a highly effective and non toxic chemical hybridizing drug in rape[3-4]. The action target of super efficient sulfonylurea herbicides is acetolactate synthase （ALS）[5]. Because ALS is not found in humans or animals， this herbicide is safe for humans and animals. Acetolactate synthase （ALS， EC4. 1. 3. 18， or acetohydroxy acid synthase， AHAS）， is the primary rate limiting enzyme in the pathway of synthesizing branched chain amino acids （BCAA）， leucine， isoleucine and valine[6-7] in plants and microorganisms， and is a protein encoded by the nuclear gene and localized in the chloroplasts of higher plants. Since ALS is the target of various herbicides and growth inhibitory substances and only presents in plants and microorganisms， so ALS inhibiting agrochemicals are safer for humans and animals. For decades， researchers in China and abroad have conducted extensive research on the breeding of rape with chemical hybridizing agents. Hunan Agricultural University， Southwest University， Sichuan University， Hybrid Rape Research Center of Shaanxi Province and other units have bred and promoted more than 20 hybrid rape varieties in the series "Xiangzayou"， "Yuhuang"， "Qinyou"， "Ningza"， etc.， by the CHA seed production technology， and significant socioeconomic benefits have produced[8-11]. Although the research on rape CHAs has made great progress especially in their use， related basic research is still very weak. The current research mainly focuses on the development and cultivation of CHAs， while basic research is relatively less， and few studies have been conducted on the change in the activity of the target enzyme ALS after the application of CHAs in rape[12]， which still needs further research. In this study， with the female parents of two national registered varieties through chemical emasculation as the experimental materials， based on the results of previous studies，  0.2  μg/ml sulfonamide was sprayed on the leaves in the single nuclear stage of microspore development of rape， and the effects of tribenuron methly on the morphology， agronomic traits， relative seed setting rate of rape and the activity of ALS were analyzed， with an attempt to provide a basis for the rapid identification of the spraying effect in early stage and the molecular mechanism of chemical hybridizing of Brassica napus L.
　　Materials and Methods
　　Materials
　　Tested B. napus L. variety （line） Ningyou 18 （the female parent of the national registered variety Ningza 1818 through chemical emasculation） and 096030 （the female parent of the national registered variety Ningza 1838 through chemical emasculation） were provided by the Institute of Industrial Crops ， Jiangsu Academy of Agricultural Sciences. These materials had undergone multiple generations of selfing. The test drug， tribenuron methly， was 10% tribenuron methly WP produced by Jiangsu Institute of Ecomones Co.， Ltd. 　　Methods
　　Field trial
　　The experiment was carried out at the Lishui Plant Science Trial Station of Jiangsu Academy of Agricultural Sciences from 2016 to 2017. Seeding was performed on October 8， 2016， with 3 replicates for each treatment. Each plot had four rows， with a row length of 3.3 m and row spacing of 0.4 m and 20 plants. The field management was the same as that of general field.
　　Tribenuron methyl treatment
　　Tribenuron methly at the concentration of 0.2 μg/ml （concentration of active ingredient） was applied on leaves. The spraying time was established by the maximum flower bud length of the main inflorescence of 70% rapeseed plants， and the spray treatment was carried out when the maximum flower bud length of rape was 1-2 mm. The drug was sprayed evenly on the leaf surface with a small manual sprayer when covering adjacent two plots with plastic cloth. The first time of foliar application was carried out at noon on February 26， 2017 at the dose of 8-10 ml per plant， and the second spraying was applied with 8-10 ml of the chemical per plant 10 d later （March 9， 2017）. The control was sprayed with the same amount of water.
　　Observation and statistical methods
　　In the initial flowering stage of rape， from the second plant of the second row of each replicate in the tribenuron methly treatment， 10 plants were selected in succession and tagged. The whole plants were bagged to allow selfing for subsequent laboratory test. For the control，  10 plants  were also selected and tagged from each replicate for subsequent laboratory test by the same method. During the flowering period of rape， three flowers which bloomed on the same day were taken from the top of each of the 10 main inflorescences at 10 am， and the length of pistils， the length of stamens and the length and width of petals were calculated. Before harvesting， the plant height， the number of branches， the length of the main inflorescences， the number of pods， the number of seeds per pod and the length of pods were investigated in the selected 10 plants， and the relative seed setting rate （the total number of seeds per plant in the treatment/the total number of seeds per plant in the control） was calculated.
　　Determination of ALS activity
　　On the 3 rd  day after the first treatment with tribenuron methly， the flower buds of about 2 mm in rape were frozen in liquid nitrogen and stored in a refrigerator at -80 ℃ for the determination of ALS  activity. The ALS activity was measured by the method of Singh[13]. The amount of  3 hydroxy 2 butanone （acetoin） ， which is the product of the enzymatic reaction with sodium pyruvate as the substrate， was measured at the wavelength of 530 nm， and the ALS ctivity was calculated. The content of 3 hydroxy 2 butanone produced by unit protein （mg） per unit time （h） is defined as enzyme activity in unit of μmol/（mg·h）. 　　ALS tissue expression characteristics
　　For the control line 096030， the roots， stems and leaves in the early flowering stage of rape， the small buds （flower bud length： 1-3 mm）， middle buds （flower bud length： 3-5 mm） and big buds （flower bud length ≥5 mm）， and the flower organs （calyxes， petals， stamens and pistils） 0 d after flowering were collected. The tissues were stored at -80 ℃ after liquid nitrogen freezing for later use. The expression of GR2 gene in different tissues was detected by real time fluorescent quantitative PCR. The PCR primers were designed using Prime 5.0. The sequences were as follows： upstream primer： 5′ GGGCATTTCACGCATTACAAC 3′， and downstream primer： 5′ CAGCAGCATTCACAGCAATCTTA 3′. The amplified fragment was expected to be 167 bp in length. The rape Actin gene was used as an internal reference， and the sequences were as follows： upstream primer： 5′ ACGAGCTACCTGACGGACAAG 3′， and downstream primer： 5′ GAGCGACGGCTGGAAGAGTA 3′. The amplified fragment was expected to be 80 bp in length.
　　Data processing
　　Data and statistical analysis were performed  using  Excel and SPSS statistical software.
　　Results and Analysis
　　Induction of male sterility in rapeseed by tribenuron methly
　　Compared with the control， the petals became smaller after the 0.2 μg/ml tribenuron methly treatment; the pistils showed no significant difference from the control; the stamens were significantly shorter than the control; and the anthers dried up （Fig. 1， Table 1）. The effects of 0.2 μg/ml tribenuron methly on the main agronomic traits of Ningyou 18 and 096030 are shown in Table 2. The 0.2 μg/ml treatment significantly inhibited plant height， pod length and number of seeds per pod， but had no significant effect on the number of branches and certain promotion on the length of main inflorescence. The relative seed setting rates of Ningyou 18 and 096030 after the 0.2 μg/ml tribenuron methly foliar treatment were only 3.97% and 4.03%， respectively. In summary， the foliar application of tribenuron methly can induce male sterility in rape， and the treatment with 0.2 μg/ml tribenuron methly for two times can induce the sterile plant rate of 100%， in the whole flowering period; and the relative seed setting rates were only  about  4%. Therefore， treatment with benzsulfuron methyl at the concentration of 0.2 μg/ml can meet the purity requirements of field seed production.
　　Change of ALS Activity in B. napus L. 　　It can be seen from Table 3 that the activity of ALS in rape under the treatment of 0.2 μg/ml tribenuron methly was significantly lower than that of the control. The ALS activity of Ningyou 18 was 3.20 and 1.30 μmol/（mg·h） in the control and the treatment， respectively. The ALS activity of 096030 was 3.730 and 1.25 μmol/（mg·h） in the control and treatment， respectively. The relative enzyme activity of ALS in Ningyou 18 and 096030 was 40.63% and 37.23%， respectively， both of which decreased significantly.
　　Tissue specific expression analysis of ALS gene in B. napus L.
　　For the control line 096030， the roots， stems and leaves in the early flowering stage， the small buds， middle buds and big buds， and the four rounds of flower organs （calyxes， petals， stamens and pistils） 0 d after flowering were directly extracted for total RNA without treatment. Real time quantitative PCR analysis was performed using reverse transcribed cDNA as a template， and the expression level in small buds was used as a control. The results showed that the ALS gene was expressed in the flower buds， the four rounds of flower organs and the vegetative organs including roots， stems and leaves of rape 096030. The expression level was highest in the leaves of 096030 and weaker in petals and stamens （Fig. 2）.
　　Discussion and Conclusions
　　The suitable concentration of tribenuron methly is an important factor affecting the chemical hybridizing effect in rape. A low concentration would cause incomplete male sterility， while a too high concentration is prone to the occurrence of phytotoxicity and affects the seed setting rate， resulting in low seed production. Although the concentration and dose can also be coordinated in use， the concentration is a more important factor than the dose. If the concentration is lower， and the dose is larger， an ideal chemical hybridizing effect cannot be achieved. Conversely， at a certain dose， a high concentration is better than a low concentration in the chemical hybridizing effect， but also has increased possibility of phytotoxicity. Previous studies have found that the chemical hybridizing concentration of sulfonylureas is the lowest at 0.02 μg/ml and the highest at 20 μg/ml. Zhang et al.[3] showed that the foliar spray of tribenuron methly in the concentration range of 0.075- 0.100  μg/ml at the dose of 15-20 ml per plant can kill the stamens thoroughly， with lighter phytotoxicity. In the study of Huang et al.[4]， tribenuron methly was sprayed on the leaves for the first time when the maximum flower bud length of main inflorescences of the main inbred lines of rape in Chengdu was 1.50-2.00 mm， and the second foliar application was carried out 10 d later at the same dose. The results showed that 0.30 μg/ml of tribenuron methly at the dose of 8-10 ml per plant can induce more than 90% of the sterile plant rate; and spraying 0.05-0.10 μg/ml of tribenuron methly at the dose of 15-20 ml per plant can induce a 100% sterile plant rate in the population， without phytotoxicity， and can maintain the infertility the entire flowering period. In this study， based on the results of previous studies， 8-10 ml of 0.2 μg/ml of tribenuron methly per plant was sprayed on leaves twice at an interval of about 10 d. Two times of the foliar application can induce a 100% sterile plant rate and can maintain the plants sterile in the whole flowering period， and the relative seed setting rate was only about 4%， which indicates that spraying 0.2 μg/ml tribenuron methly for two times can meet the purity requirements of field seed production. 　　One difficulty that hinders the promotion and application of rapeseed CHAs is the evaluation of the effects of CHAs after use. Previous studies have focused only on the evaluation of the effects of CHAs from flower organ morphology and field agronomic traits including size and diameter of petals， change in stigma length， seed setting rate， plant fertility and plant height. These indicators are essential for the experimental techniques of CHAs， but these  evaluation  indicators are basically obtained in the middle and late stages of the drug effect and during the fruiting period， and there is no way to predict the application amount and the spraying effect of CHAs. If phytotoxicity occurs or the spraying amount is insufficient， it will be too late to remediate at this time， that is to say， spraying antidotes and safeners or replenishing CHAs will be too late. Therefore， how to quickly identify the spraying effect in the early stage has become an urgent problem to be solved. In recent years， there have been many rapid identification methods for the resistance of plants to herbicides by measuring ALS activity[14-15]. The research results of Li et al.[16] showed that the differences in ALS activity between different wheat varieties in Xinjiang are extremely significant. Liu et al.[17] have found that there are differences in resistance to ALS inhibitor herbicides between different crops and even different crop varieties of the same species and the tolerance of different wheat varieties to pyroxsulam is also extremely significant. Recent studies have demonstrated that the change in the expression level of ALS gene and its mutation can affect resistance to herbicides at the molecular level[18-20]， indicating that this is also an effective method. In this study， the tissue specific expression analysis showed that the ALS gene had tissue expression specificity， and it was expressed at the highest level in the leaves， and also expressed in the four rounds of flower organs （calyxes， petals， carpels and stamens）， indicating that ALS is involved in plant development and participates in the development of flower organs. The gene was expressed at the lowest level in petals and stamens， indicating that the expression in stamens is susceptible. In this study， we attempted to measure the activity of ALS in the early stage of spraying in vivo， and to quickly identify and predict whether the spray amount reached the reasonable range of the CHA by comparing the difference between the control and the treatment group. The results showed that the activity of ALS significantly decreased in the treatment groups of the two rapeseed varieties compared with the control groups， and the relative enzyme activity of ALS was 40.63% and 37.23%， respectively， which decreased significantly， indicating that the change of ALS activity may be used as an indicator for the rapid identification and prediction of whether the spray amount of the chemical hybridizing agent reaches a reasonable range. However， previous studies have shown that different maize varieties have different susceptibility to monosulfuron. The results of studies on in vitro ALS indicate that monosulfuron has different effects on the activity of ALS in different maize varieties， but showed no big differences in the effect on ALS activity between maize of the same inbred line. A low concentration of monosulfuron could stimulate the activity of ALS in vivo， while a high concentration has an inhibitory effect[21]. Therefore， establishing the functional relationship between the activity of ALS and the spray amounts corresponding to different agents and different varieties requires establishing multi year statistical data relationships  among  variety characteristics， plant size， ALS activity and drug absorption， to obtain more accurate doses， which need further study. 　　References
　　[1] FU TD. Oil research and application of heterosis in rapeseed[J]. Chinese Journal of Oil Crop Sciences， 2008， 30 （z1）： 1-5. （in Chinese）
　　[2] ZHANG ZQ， WANG GH， GUAN CY， et al. Research Advances in Chemical Emasculation of Rape[J]. Hunan Agricultural Sciences， 2011， （5）： 19-22. （in Chinese）
　　[3] ZHANG BJ， ZHAO HX， HU SW. Male sterile inducing ability of tribenuron methyl to rapeseed cultivar Zhongshuang 9[J]. Chinese Journal of Oil Crop Sciences， 2010， 32（4）： 467-471. （in Chinese）
　　[4] HUANG C， HU HB， PU XB， et al. Effects of male sterilization of Brassica napus L. induced by tribenuron methyl in Chengdu region[J]. Southwest China Journal of Agricultural Sciences， 2015， 28（3）： 1097-1104. （in Chinese）
　　[5] PANG SS， DUGGLEBY RG， GUDDAT LW. Crystal structure of yeast acetohydroxyacid synthase： A target for herbicidal inhibitors[J]. J Mol Biol， 2002， 317： 249-262.
　　[6] YU CY. Characterization and work mechanism of chemical hybridizing agents for plants[D]. Yangling： Northwest Agriculture & Forestry University， 2009. （in Chinese）
　　[7] MCCOURT JA， DUGGLEBY RG. Acetohydroxyacid synthase and its role in the biosynthetic pathway for branched chain amino acids[J]. Amino Acids， 2006， 31： 173-210.
　　[8] CHEN SY， GUAN CY， WANG GH， et al. Breeding of a new double low hybrid rapeseed cultivar Xiangzayou 6[J]. Chinese Journal of Oil Crop Sciences， 2005， 27（2）： 37-39. （in Chinese）
　　[9] CHEN L， LI GN， TANG ZL， et al. Breeding of "Yuhuang 1" ——A new yellow seeded hybrid cultivar of rape （Brassica napus L.）[J]. Journal of Southwest Agricultural University， 2002， 24（1）： 45-47. （in Chinese）
　　[10] WANG AN， WANG H， ZHAO YJ， et al. Purity identification of chemical hybriding male varieties of hybrid rape Qinyou 33 using SSR markers[J]. Chinese journal of agricultural biotechnology， 2011， 19（6）：  1011-1018. （in Chinese）
　　[11] FU SX， QI CK， GU H， et al. Breeding of high quality two line hybrid rape variety Ningza 1818 through chemical emasculation[J]. Acta Agriculturae Jiangxi， 2015， 27（7）：  11-14. （in Chinese）
　　[12] LIU ZQ， LIU QQ， YU CY， et al. Evaluation of inhibiting effects of 5 herbicides on acetolactate synthase activities and gametocidal effect in rapeseed[J]. Chinese Journal of Oil Crop Sciences， 2016， 38（6）：  742-749.  （in Chinese）
　　[13] SINGH BK， STIDHAM MA， SHANER DL. Assay of acetohydroxyacid synthase[J]. Ann Biochem， 1988， 171： 173-179. 　　[14] CROSS RB， MCCARTY LB， THARAYIL N， et al. Detecting annual bluegrass （Poa annua） resistance to ALS inhibiring herbicides using a rapid diagnostic assay[J]. Weed Sci， 2013， 61（3）： 384-389.
　　[15] VEGA T， BRECCIA G， GIL M， et al. Acetohydroxyacid synthase （AHAS） in vivo assay for screening imidazolinone resistance in sunflower （Helianthus annuus L.） [J]. Plant Physiol Biochem， 2012， 61：  103-107.
　　[16] LI YD， DONG X， HE S， et al. Effects of pyroxsulam on acetolactate aynthetase activity of main wheat varieties in Xinjiang[J]. Acta Agriculturae Boreali occidentalis Sinica， 2017， 26（4）： 560-567. （in Chinese）
　　[17] LIU W， WANG JX， YANG GL， et al. Difference of tolerance and mechanism of various wheat varieties to tribenuron methyl[J]. Journal of Plant Protection， 2005， 32（3）： 300-304. （in Chinese）
　　[18] YAO X， WANG YQ YUE XP， et al. Generation of tribenuron methyl herbicide resistant OsCYP81A6 expressing rapeseed （Brassica napus L.） plants for hybrid seed production using chemical induced male sterility[J]. Plant Breeding， 2016， 135（3）： 349-354.
　　[19] LI T， LIU B， CHEN CY， et al. TALEN mediated homologous recombination produces site directed DNA base change and herbicide resistant rice[J]. J Genet Genom， 2016， 43（5）： 297-305.
　　[20] BRECCIA G， VEGA T， FELITTI SA， et al. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide[J]. Plant Sci， 2013， 208： 28-33.
　　[21] FAN ZJ， CHEN JP， DANG HB， et al. Effect of monosulfuron on the activity of its target enzyme acetolactate synthase[J]. Modern Agrochemicals， 2003， 2（2）： 16-17. （in Chinese）